%0 Journal Article %1 ijbiotech %A Wibowo, M. Haryadi %A Susetya, Heru %A Untari, Tri %A Putri, Khrisdiana %A Tabbu, Charles Rangga %A Asmara, Widya %D 2006 %I Research Center for Biotechnology %J Indonesian Journal of Biotechnology %K avian cleavage hemagglutinin, influenza, lesion, phylogeny. site, %N 2 %P 901-907 %T Molecular Study on The Pathogenicity of Avian Influenza Virus %U http://ijbiotech.ugm.ac.id/index.php/biotech/article/view/83 %V 11 %X Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer desaigned for amplification and sequence was H5-F: 5andrsquo; ggagactcagcaatcccatgaaaag 3andrsquo; and H5-R:5andrsquo;ccataccaaccgtctaccattcc 3andrsquo;, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA genefragment indicated that each type of characteristic lesion created philo-groups.

@article{ijbiotech, abstract = {Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer desaigned for amplification and sequence was H5-F: 5andrsquo; ggagactcagcaatcccatgaaaag 3andrsquo; and H5-R:5andrsquo;ccataccaaccgtctaccattcc 3andrsquo;, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino acid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HA genefragment indicated that each type of characteristic lesion created philo-groups.}, added-at = {2010-12-15T00:27:17.000+0100}, author = {Wibowo, M. Haryadi and Susetya, Heru and Untari, Tri and Putri, Khrisdiana and Tabbu, Charles Rangga and Asmara, Widya}, biburl = {https://www.bibsonomy.org/bibtex/218a86a59a349ae7172d5c7e375e68354/ijbiotech}, interhash = {07271a85d46b79c04601bc7fb001066a}, intrahash = {18a86a59a349ae7172d5c7e375e68354}, journal = {Indonesian Journal of Biotechnology}, keywords = {avian cleavage hemagglutinin, influenza, lesion, phylogeny. site,}, number = 2, pages = {901-907}, publisher = {Research Center for Biotechnology}, timestamp = {2010-12-15T00:27:18.000+0100}, title = {Molecular Study on The Pathogenicity of Avian Influenza Virus}, url = {http://ijbiotech.ugm.ac.id/index.php/biotech/article/view/83}, volume = 11, year = 2006 }